Trajectory of intrinsic capacity among community-dwelling older adults in China: The China health and retirement longitudinal study.

BACKGROUNDS: Intrinsic capacity (IC), the sum of individual mental and physical capabilities, as well as living environment and behavior, jointly determine the functional ability of older adults, shifting the focus from disease to function. At the population level, IC in older adults is associated with adverse health outcomes, such as disability, falls, and death. At the individual level, IC changes dynamically. However, studies on the longitudinal IC trajectory and the factors influencing IC deterioration are limited. We aimed to analyze the IC trajectory and explore the risk factors for IC deterioration in Chinese older adults. METHODS: Data were obtained from the baseline (2011-2012) and 4-year follow-up (2015) CHARLS surveys, including 1906 people aged 60 years and older. IC comprises six dimensions: locomotion, vitality, hearing, vision, cognition, and psychology. IC trajectory was categorized into three groups: improved, maintained, and deteriorated. Logistic regression analysis was used to analyze factors influencing the trajectory of IC deterioration. RESULTS: After 4 years, 32.1 % had deteriorated, 38.5 % remained stable, and 29.4 % had improved. Age, low level of education, widowed were independently associated with IC deterioration. CONCLUSIONS: Dynamic IC monitoring supports the development of individualized intervention policies to delay or prevent IC deterioration.

Inflammatory Markers Associated with Physical Frailty and Cognitive Impairment.

In older adults, physical frailty and cognitive impairment contribute to adverse outcomes. However, the research on mechanisms underlying physical frailty and cognitive impairment is limited. Low-grade chronic inflammation is a characteristic of aging. Particularly, an imbalance in pro- and anti-inflammatory mechanisms may be involved in frailty and neurodegenerative disorders. Therefore, exploring the inflammatory markers of physical frailty and cognitive impairment is crucial to fully understanding these mechanisms and establishing a substantial link between these two disorders. Notably, few studies have focused on exploring inflammatory markers in both physical frailty and cognitive impairment, posing a major challenge in elucidating the link between them. Therefore, substantial efforts are required for the better prevention of physical frailty and cognitive impairment. In this review, we explored the role of inflammatory markers as a potential link between frailty and cognitive impairment.

The polymorphism analysis for CD36 among platelet donors.

CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.

Research on different compound combinations of Realgar-Indigo naturalis formula to reverse acute promyelocytic leukemia arsenic resistance by regulating autophagy through mTOR pathway.

ETHNOPHARMACOLOGICAL RELEVANCE: In China, the Chinese patent drug Realgar-Indigo naturalis Formula (RIF) is utilized for the therapy of acute promyelocytic leukemia (APL). Comprising four traditional Chinese herb-Realgar, Indigo naturalis, Salvia miltiorrhiza, and Pseudostellaria heterophylla-it notably includes tetra-arsenic tetra-sulfide, indirubin, tanshinone IIa, and total saponins of Radix Pseudostellariae as its primary active components. Due to its arsenic content, RIF distinctly contributes to the therapy for APL. However, the challenge of arsenic resistance in APL patients complicates the clinical use of arsenic agents. Interestingly, RIF demonstrates a high remission rate in APL patients, suggesting that its efficacy is not significantly compromised by arsenic resistance. Yet, the current state of research on RIF's ability to reverse arsenic resistance remains unclear. AIM OF THE STUDY: To investigate the mechanism of different combinations of the compound of RIF in reversing arsenic resistance in APL. MATERIALS AND METHODS: The present study utilized the arsenic-resistant HL60-PMLA216V-RARα cell line to investigate the effects of various RIF compounds, namely tetra-arsenic tetra-sulfide (A), indirubin (I), tanshinone IIa (T), and total saponins of Radix Pseudostellariae (S). The assessment of cell viability, observation of cell morphology, and evaluation of cell apoptosis were performed. Furthermore, the mitochondrial membrane potential, changes in the levels of PMLA216V-RARα, apoptosis-related factors, and the PI3K/AKT/mTOR pathway were examined, along with autophagy in all experimental groups. Meanwhile, we observed the changes about autophagy after blocking the PI3K or mTOR pathway. RESULTS: Tanshinone IIa, indirubin and total saponins of Radix Pseudostellariae could enhance the effect of tetra-arsenic tetra-sulfide down-regulating PMLA216V-RARα, and the mechanism was suggested to be related to inhibiting mTOR pathway to activate autophagy. CONCLUSIONS: We illustrated that the synergistic effect of different compound combinations of RIF can regulate autophagy through the mTOR pathway, enhance cell apoptosis, and degrade arsenic-resistant PMLA216V-RARα.

Dysregulation of acyl carnitines, pentose phosphate pathway and arginine and ornithine metabolism are associated with decline in intrinsic capacity in Chinese older adults.

BACKGROUND: Intrinsic capacity is the combination of individual physical and mental abilities, reflecting the aging degree of the older adults. However, the mechanisms and metabolic characteristics of the decline in intrinsic capacity are still unclear. AIMS: To identify metabolic signatures and associated pathways of decline in intrinsic capacity based on the metabolite features. METHODS: We recruited 70 participants aged 77.19 ± 8.31 years. The five domains of intrinsic capacity were assessed by Short Physical Performance Battery (for mobility), Montreal cognition assessment (for cognition), 30-Item Geriatric Depression Scale (for psychology), self-reported hearing/visual impairment (for sensory) and Nutritional risk screening (for vitality), respectively. The serum samples of participants were analyzed by liquid chromatography-mass spectrometry-based metabolomics, followed by metabolite set enrichment analysis and metabolic pathway analysis. RESULTS: There were 50 participants with a decline in intrinsic capacity in at least one of the domains. A total of 349 metabolites were identified from their serum samples. Overall, 24 differential metabolites, 5 metabolite sets and 13 pathways were associated with the decline in intrinsic capacity. DISCUSSION: Our results indicated that decline in intrinsic capacity had unique metabolomic profiles. CONCLUSION: The specific change of acyl carnitines was observed to be a feature of decline in intrinsic capacity. Dysregulation of the pentose phosphate pathway and of arginine and ornithine metabolism was strongly associated with the decline in intrinsic capacity.

Self-Trapping of Slow Electrons in the Energy Domain.

The interaction of light and swift electrons has enabled phase-coherent manipulation and acceleration of electron wave packets. Here, we investigate this interaction in a new regime where low-energy electrons (∼20-200 eV) interact with a phase-matched light field. Our analytical and one-dimensional numerical study shows that slow electrons are subject to strong confinement in the energy domain due to the nonvanishing curvature of the electron dispersion. The spectral trap is tunable and an appropriate choice of light field parameters can reduce the interaction dynamics to only two energy states. The capacity to trap electrons expands the scope of electron beam physics, free-electron quantum optics and quantum simulators.

Inflammatory markers and physical frailty: towards clinical application.

Global population aging poses a tremendous burden on the health care system worldwide. Frailty is associated with decreased physical reserve and is considered an important indicator of adverse events in the older population. Therefore, there is growing interest in the early diagnosis and intervention of frailty, but the cellular mechanisms responsible for frailty are still not completely understood. Chronic inflammation is related to decreased physical function and increased disease risk. Additionally, multiple human and animal studies suggest that inflammation probably plays the largest role in contributing to frailty. Some inflammatory markers have been proposed to predict physical frailty. However, there are still large gaps in knowledge related to the clinical application of these markers in frail patients. Therefore, understanding the biological processes and identifying recognized and reliable markers are urgent and pivotal tasks for geriatricians. In the present review, we broadly summarize the inflammatory markers that may have potential diagnostic and therapeutic use, thereby translating them into health care for older people with frailty in the near future.

The circUbqln1, regulated by XBP1s, interplays with 14-3-3ζ to inhibit collagen synthesis and promote osteoarthritis by controlling PRODH activity and proline metabolism.

INTRODUCTION: Osteoarthritis (OA) is a degenerative bone disease associated with ageing, characterized by joint pain, stiffness, swelling and deformation. Currently, pharmaceutical options for the clinical treatment of OA are very limited. Circular RNAs(cirRNAs) have garnered significant attention in OA and related drug development due to their unique RNA sequence characteristics.Therefore,exploring the role of cirRNAs in the occurrence and development of OA is of paramount importance for the development of effective medications for OA. OBJECTIVES: To identify a novel circRNA, circUbqln1, for treating osteoarthritis and elucidate its pathophysiological role and mechanisms in the treatment of OA. METHODS: The circUbqln1 expression and distribution were determined by qRT-PCR and FISH. XBP1 gene knockout(XBP1 cKO) spontaneous OA and DMM model and WT mouse CIOA model were used to explore the role of XBP1 and circUbqln1 in OA.Overexpression or knockdown of circUbqln1 lentivirus was used to observe the impacts of circUbqln1 on primary chondrocytes,C28/I2 and mice in vitro and in vivo.Chromatin immunoprecipitation,luciferase reporter assay,RNA pulldown,mass spectrometry,RNA immunoprecipitation,fluorescence in situ hybridization,and flow cytometry to explore the molecular mechanisms of circUbqln1. RESULTS: It was found that cartilage-specific XBP1 cKO mice exhibited a faster OA progression compared to normal's.Importantly,transcript factor XBP1s has the capacity to impede the biogenesis of circUbqln1,derived from Ubqln1. The circUbqln1 promotes cartilage catabolism and inhibits anabolism, therefore accelerates the occurrence of OA.Mechanismly,circUbqln1 can translocate to the chondrocyte nucleus with the assistance of phosphorylated 14-3-3ζ, upregulate the transcriptional activity of the proline dehydrogenase(Prodh) promoter and PRODH enzyme activity. Consequently, this leads to the promotion of proline degradation and the inhibition of collagen synthesis,ultimately culminating in the impairment of cartilage and its structural integrity. CONCLUSION: CircUbqln1 plays a crucial role in the occurrence and development of OA, indicating that the inhibition of circUbqln1 holds promise as a significant approach for treating OA in the future.

Identification and functional coordination analysis of gene co-expression networks in different tissues of XBP1 cartilage-specific deficient mice.

Abnormal differentiation and proliferation of chondrocytes leads to various diseases related to growth and development. The process of chondrocyte differentiation involves a series of complex cellular and molecular interactions. X-box binding protein 1 (XBP1), an essential molecule of the unfolded protein response (UPR) in Endoplasmic Reticulum (ER) stress, participated in cartilage development and causes other related diseases. We previously reported that XBP1 deficiency in cartilage impacts the function and associated diseases of many different tissues including cartilage. However, how differential expression of genes modulates the roles of cartilage and other tissues when XBP1 is lack of in chondrocytes remains unclear. We aimed to screen for differentially expressed (DE) genes in cartilage, brain, heart, and muscle by high-throughput sequencing in XBP1 cartilage-specific knockout (CKO) mice. Further, gene co-expression networks were constructed by weighted gene co-expression network analysis (WGCNA) algorithm and pivot genes were identified in the above four tissues. Protein detection, Hematoxylin-eosin (HE) staining and immunohistochemistry (IHC) experiments have proved that these differentially co-expressed genes participate in the downstream regulatory pathway of different tissues and affect tissue function.Significantly differentially expressed mRNAs [differentially expressed genes (DEGs)] were identified between XBP1 CKO mice and controls in cartilage, brain, heart, and muscle tissues, including 610, 126, 199 and 219 DEGs, respectively. 39 differentially co-expressed genes were identified in the above four tissues, and they were important pivot genes. Comprehensive analysis discovered that XBP1 deficiency in cartilage influences the difference of co-expressed genes between cartilage and other different tissues. These differentially co-expressed genes participate in downstream regulatory pathways of different tissues and affect tissue functions. Collectively, our conclusions may contribute potential biomarkers and molecular mechanisms for the mutual modulation between cartilage and different tissues and the diagnosis and treatment of diseases caused by abnormalities in different tissues. The analysis also provides meaningful insights for future genetic discoveries.

IRE1α protects against osteoarthritis by regulating progranulin-dependent XBP1 splicing and collagen homeostasis.

Osteoarthritis (OA) is a full-joint, multifactorial, degenerative and inflammatory disease that seriously affects the quality of life of patients due to its disabling and pain-causing properties. ER stress has been reported to be closely related to the progression of OA. The inositol-requiring enzyme 1α/X-box-binding protein-1 spliced (IRE1α/XBP1s) pathway, which is highly expressed in the chondrocytes of OA patients, promotes the degradation and refolding of abnormal proteins during ER stress and maintains the stability of the ER environment of chondrocytes, but its function and the underlying mechanisms of how it contributes to the progression of OA remain unclear. This study investigates the role of IRE1α/ERN1 in OA. Specific deficiency of ERN1 in chondrocytes spontaneously resulted in OA-like cartilage destruction and accelerated OA progression in a surgically induced arthritis model. Local delivery of AdERN1 relieved degradation of the cartilage matrix and prevented OA development in an ACLT-mediated model. Mechanistically, progranulin (PGRN), an intracellular chaperone, binds to IRE1α, promoting its phosphorylation and splicing of XBP1u to generate XBP1s. XBP1s protects articular cartilage through TNF-α/ERK1/2 signaling and further maintains collagen homeostasis by regulating type II collagen expression. The chondroprotective effect of IRE1α/ERN1 is dependent on PGRN and XBP1s splicing. ERN1 deficiency accelerated cartilage degeneration in OA by reducing PGRN expression and XBP1s splicing, subsequently decreasing collagen II expression and triggering collagen structural abnormalities and an imbalance in collagen homeostasis. This study provides new insights into OA pathogenesis and the UPR and suggests that IRE1α/ERN1 may serve as a potential target for the treatment of joint degenerative diseases, including OA.

Weak measurements and quantum-to-classical transitions in free electron-photon interactions.

How does the quantum-to-classical transition of measurement occur? This question is vital for both foundations and applications of quantum mechanics. Here, we develop a new measurement-based framework for characterizing the classical and quantum free electron-photon interactions and then experimentally test it. We first analyze the transition from projective to weak measurement in generic light-matter interactions and show that any classical electron-laser-beam interaction can be represented as an outcome of weak measurement. In particular, the appearance of classical point-particle acceleration is an example of an amplified weak value resulting from weak measurement. A universal factor, [Formula: see text], quantifies the measurement regimes and their transition from quantum to classical, where [Formula: see text] corresponds to the ratio between the electron wavepacket size and the optical wavelength. This measurement-based formulation is experimentally verified in both limits of photon-induced near-field electron microscopy and the classical acceleration regime using a DLA. Our results shed new light on the transition from quantum to classical electrodynamics, enabling us to employ the essence of the wave-particle duality of both light and electrons in quantum measurement for exploring and applying many quantum and classical light-matter interactions.

A novel NET-related gene signature for predicting DLBCL prognosis.

BACKGROUND: Diffuse large B-cell lymphoma (DLBCL) is an aggressive malignancy. Neutrophil extracellular traps (NETs) are pathogen-trapping structures in the tumor microenvironment that affect DLBCL progression. However, the predictive function of NET-related genes (NRGs) in DLBCL has received little attention. This study aimed to investigate the interaction between NRGs and the prognosis of DLBCL as well as their possible association with the immunological microenvironment. METHODS: The gene expression and clinical data of patients with DLBCL were downloaded from the Gene Expression Omnibus database. We identified 148 NRGs through the manual collection of literature. GSE10846 (n = 400, GPL570) was used as the training dataset and divided into training and testing sets in a 7:3 ratio. Univariate Cox regression analysis was used to identify overall survival (OS)-related NETs, and the least absolute shrinkage and selection operator was used to evaluate the predictive efficacy of the NRGs. Kaplan-Meier plots were used to visualize survival functions. Receiver operating characteristic (ROC) curves were used to assess the prognostic predictive ability of NRG-based features. A nomogram containing the clinical information and prognostic scores of the patients was constructed using multivariate logistic regression and Cox proportional risk regression models. RESULTS: We identified 36 NRGs that significantly affected patient overall survival (OS). Eight NRGs (PARVB, LYZ, PPARGC1A, HIF1A, SPP1, CDH1, S100A9, and CXCL2) were found to have excellent predictive potential for patient survival. For the 1-, 3-, and 5-year survival rates, the obtained areas under the receiver operating characteristic curve values were 0.8, 0.82, and 0.79, respectively. In the training set, patients in the high NRG risk group presented a poorer prognosis (p < 0.0001), which was validated using two external datasets (GSE11318 and GSE34171). The calibration curves of the nomogram showed that it had excellent predictive ability. Moreover, in vitro quantitative real-time PCR (qPCR) results showed that the mRNA expression levels of CXCL2, LYZ, and PARVB were significantly higher in the DLBCL group. CONCLUSIONS: We developed a genetic risk model based on NRGs to predict the prognosis of patients with DLBCL, which may assist in the selection of treatment drugs for these patients.

Vibrational Dichroism of Chiral Valley Phonons.

Valley degrees of freedom in transition metal dichalcogenides thoroughly influence electron-phonon coupling and its nonequilibrium dynamics. We conducted a first-principles study of the quantum kinetics of chiral phonons following valley-selective carrier excitation with circularly polarized light. Our numerical investigations treat the ultrafast dynamics of electrons and phonons on equal footing within a parameter-free ab initio framework. We report the emergence of valley-polarized phonon populations in monolayer MoS2 that can be selectively excited at either the K or K' valleys depending on the light helicity. The resulting vibrational state is characterized by a distinctive chirality, which lifts time-reversal symmetry of the lattice on transient time scales. We show that chiral valley phonons can further lead to fingerprints of vibrational dichroism detectable by ultrafast diffuse scattering and persist beyond 10 ps. The valley polarization of nonequilibrium phonon populations could be exploited as an information carrier, thereby extending the paradigm of valleytronics to the domain of vibrational excitations.

Reward motivation adaptation in people with negative schizotypal features: development of a novel behavioural paradigm and identifying its neural correlates using resting-state functional connectivity analysis.

Reward motivation in individuals with high levels of negative schizotypal traits (NS) has been found to be lower than that in their counterparts. But it is unclear that whether their reward motivation adaptively changes with external effort-reward ratio, and what resting-state functional connectivity (rsFC) is associated with this change. Thirty-five individuals with high levels of NS and 44 individuals with low levels of NS were recruited. A 3T resting-state functional brain scan and a novel reward motivation adaptation behavioural task were administrated in all participants. The behavioural task was manipulated with three conditions (effort > reward condition vs. effort < reward condition vs. effort = reward condition). Under each condition were rated 'wanting' and 'liking' for rewards. The seed-based voxel-wise rsFC analysis was conducted to explore the rsFCs associated with the 'wanting' and 'liking' ratings in individuals with high levels of NS. 'Wanting' and 'liking' ratings of individuals with high levels of NS significantly declined in the effort > reward condition but did not rebound as high as their counterparts in the effort < reward condition. The rsFCs in NS group associated with these ratings were altered. The altered rsFCs in NS group involved regions in the prefrontal lobe, dopaminergic brain regions (ventral tegmental area, substantia nigra), hippocampus, thalamus and cerebellum. Individuals with high levels of NS manifested their reward motivation adaptation impairment as a failure of adjustment adaptively during effort-reward imbalance condition and altered rsFCs in prefrontal, dopaminergic and other brain regions.

Progranulin regulation of autophagy contributes to its chondroprotective effect in osteoarthritis.

Progranulin (PGRN) is a multifunctional growth factor involved in many physiological processes and disease states. The apparent protective role of PGRN and the importance of chondrocyte autophagic function in the progression of osteoarthritis (OA) led us to investigate the role of PGRN in the regulation of chondrocyte autophagy. PGRN knockout chondrocytes exhibited a deficient autophagic response with limited induction following rapamycin, serum starvation, and IL-1ß-induced autophagy. PGRN-mediated anabolism and suppression of IL-1ß-induced catabolism were largely abrogated in the presence of the BafA1 autophagy inhibitor. Mechanistically, during the process of OA, PGRN and the ATG5-ATG12 conjugate form a protein complex; PGRN regulates autophagy in chondrocytes and OA through, at least partially, the interactions between PGRN and the ATG5-ATG12 conjugate. Furthermore, the ATG5-ATG12 conjugate is critical for cell proliferation and apoptosis. Knockdown or knockout of ATG5 reduces the expression of ATG5-ATG12 conjugate and inhibits the chondroprotective effect of PGRN on anabolism and catabolism. Overexpression of PGRN partially reversed this effect. In brief, the PGRN-mediated regulation of chondrocyte autophagy plays a key role in the chondroprotective role of PGRN in OA. Such studies provide new insights into the pathogenesis of OA and PGRN-associated autophagy in chondrocyte homeostasis.

Quantum wave function reconstruction by free-electron spectral shearing interferometry.

The quantum wave function measurement of a free electron remains challenging in quantum mechanics and is subject to disputes about ψ-ontic/epistemic interpretations of the wave function. Here, we theoretically propose a realistic spectral method for reconstructing quantum wave function of an electron pulse, free-electron spectral shearing interferometry (FESSI). We use a Wien filter to generate two time-delayed replicas of the electron wave packet and then shift one replica in energy using a light-electron modulator driven by a mid-infrared laser. As a direct demonstration, we numerically reconstruct a pulsed electron wave function with a kinetic energy of 10 keV. FESSI is experimentally feasible and enables us to fully determine distinct orders of spectral phases and their physical implications in quantum foundations and quantum technologies, providing a universal approach to characterize ultrashort electron pulses.

The prediction of effort-reward imbalance for reward motivation.

This sequential mediation analysis study examined how the baseline effort-reward imbalance (ERI) would predict reward motivation 1 year later in 435 college students. We found that negative/disorganized schizotypal traits and anticipatory pleasure experience together mediate the prediction of ERI for reward motivation.

Floquet Gauge Anomaly Inflow and Arbitrary Fractional Charge in Periodically Driven Topological-Normal Insulator Heterostructures.

Usually, when coupling in a background gauge field, topological zero modes would yield an anomalous current at the interface, culminating in the zero-mode anomaly inflow, which is ultimately conserved by extra contributions from the topological bulk. However, the anomaly inflow mechanism for guiding Floquet steady states is rarely explored in periodically driven systems. Here we synthesize a driven topological-normal insulator heterostructure and propose a Floquet gauge anomaly inflow, associated with the occurrence of arbitrary fractional charge. Through our photonic modeling, we experimentally observed a Floquet gauge anomaly as the system was driven into anomalous topological phases. Prospectively, we believe our findings could pave a novel avenue on exploring Floquet gauge anomalies in driven systems of condensed matter, photonics, and ultracold atoms.

Integrated transcriptome and metabolome analysis unveil the response mechanism in wild rice (Zizania latifolia griseb.) against sheath rot infection.

Sheath rot disease (SRD) is one of the most devastating diseases of Manchurian wild rice (MWR) (Zizania latifolia Griseb). Pilot experiments in our laboratory have shown that an MWR cultivar "Zhejiao NO.7"exhibits signs of SRD tolerance. To explore the responses of Zhejiao No. 7 to SRD infection, we used a combined transcriptome and metabolome analysis approach. A total of 136 differentially accumulated metabolites (DAMs, 114 up- and 22 down-accumulated in FA compared to CK) were detected. These up-accumulated metabolites were enriched in tryptophan metabolism, amino acid biosynthesis, flavonoids, and phytohormone signaling. Transcriptome sequencing results showed the differential expression of 11,280 genes (DEGs, 5,933 up-, and 5,347 downregulated in FA compared to CK). The genes expressed in tryptophan metabolism, amino acid biosynthesis, phytohormone biosynthesis and signaling, and reactive oxygen species homeostasis confirmed the metabolite results. In addition, genes related to the cell wall, carbohydrate metabolism, and plant-pathogen interaction (especially hypersensitive response) showed changes in expression in response to SRD infection. These results provide a basis for understanding the response mechanisms in MWR to FA attack that can be used for breeding SRD-tolerant MWR.

Superluminal k-Gap Solitons in Nonlinear Photonic Time Crystals.

We propose superluminal solitons residing in the momentum gap (k gap) of nonlinear photonic time crystals. These gap solitons are structured as plane waves in space while being periodically self-reconstructing wave packets in time. The solitons emerge from modes with infinite group velocity causing superluminal evolution, which is the opposite of the stationary nature of the analogous Bragg gap soliton residing at the edge of an energy gap (or a spatial gap) with zero group velocity. We explore the faster-than-light pulsed propagation of these k-gap solitons in view of Einstein's causality by introducing a truncated input seed as a precursor of a signal velocity forerunner, and find that the superluminal propagation of k-gap solitons does not break causality.